DNA Binding Site

Accessions: 5h3r_C (3D-footprint 20231221)
Organisms: Escherichia coli, strain K12
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 20
Sequence: ATACTTGCCTGGGCAATATT
Type: Heterodimer
Binding TFs: 5h3r_A (MarR family, MarR family, Winged helix DNA-binding domain)
5h3r_B (MarR family, MarR family, Winged helix DNA-binding domain)
Binding Motifs: 5h3r_A AnnTTGCC
5h3r_AB TnnTTGCCnGGGCAAnnT
Publications: Zhu R, Hao Z, Lou H, Song Y, Zhao J, Chen Y, Zhu J, Chen PR. Structural characterization of the DNA-binding mechanism underlying the copper(II)-sensing MarR transcriptional regulator. J Biol Inorg Chem 22:685-693 (2017). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.