DNA Binding Site
Accessions: | aprE_1 (DBTBS 1.0) |
Names: | aprE_1 |
Organisms: | Bacillus subtilis |
Libraries: | DBTBS 1.0 1 1 Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic acids research 36:D93-6 (2008). [Pubmed] |
Length: | 73 |
Sequence: | aaaatcatctcaaaaaaatgggtctactaaaatattattccatctattacaataaattca cagaatagtcttt |
Binding TFs: | AbrB (Antidote-toxin recognition MazE) |
Binding Motifs: | AbrB vkkTkmCAWwAA |
Publications: | Strauch M.A, Spiegelman G.B, Perego M, Johnson W.C, Burbulys D, Hoch J.A. The transition state transcription regulator abrB of Bacillus subtilis is a DNA binding protein. The EMBO journal 8:1615-21 (1989). [Pubmed] Ferrari E, Howard S.M, Hoch J.A. Effect of stage 0 sporulation mutations on subtilisin expression. Journal of bacteriology 166:173-9 (1986). [Pubmed] Ogura M, Shimane K, Asai K, Ogasawara N, Tanaka T. Binding of response regulator DegU to the aprE promoter is inhibited by RapG, which is counteracted by extracellular PhrG in Bacillus subtilis. Molecular microbiology 49:1685-97 (2003). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.