Database 'DBTBS 1.0' (DNA Binding Sites 1201-1250)
If you want to search for an specific entry use the Search Entry Form.If you want to search for a protein sequence or a DNA motif use the Sequence Search Form.
Pages: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
Accessions | Names | Sequence | Organisms |
---|---|---|---|
ywnJ_1 | ywnJ_1 | aacaGTCTTaatgaagaaaacgTCTATCCTTGtgatgggc | Bacillus subtilis |
ywnJ_2 ywnJ_3 | ywnJ_2, ywnJ_3 | tttttttcTGTTACTTTTtgctttgttttacCGTCtatgtagttacatgtagg | Bacillus subtilis |
ywoA_1 | ywoA_1 | ttattTGAAACttttcatgagtaagattAGTCtactaaatataa | Bacillus subtilis |
ywoA_2 | ywoA_2 | ttattTGAAACttttcatgagtaagattAGTCTActaaatataa | Bacillus subtilis |
ywoE_1 | ywoE_1 | tgtctctTTTTCTTGTTTAAgctgttcaaatacaaacgggaaaattgtata | Bacillus subtilis |
ywoE_2 | ywoE_2 | atagccaGTGTTAttgtctgactcttcagtTATATTaagtgacatctaa | Bacillus subtilis |
ywpH_1 | ywpH_1 | AAAAgtacaTATTtcttcaaagga | Bacillus subtilis |
ywpH_2 | ywpH_2 | aaaaaagcAAAAgatgtTTTT | Bacillus subtilis |
ywrD | ywrD | cgtcagtttttctgccg | Bacillus subtilis |
ywrE | ywrE | ttttaTGAAACGTttttcctttttcttCGTATAaaggtagatt | Bacillus subtilis |
ywtG | ywtG | taaaaAGGTTTaatggccggaaaaagAGGCTAAaagatttctaaaaaaatccc | Bacillus subtilis |
yxaG | yxaG | tcctacaATTATATAGAACGGTCTAgacaaatgaatgatAATATATAGACTGGTCTAaattggaggaagc | Bacillus subtilis |
yxeB | yxeB | ctatattattaattGATAATGATAATCATTACTaatctattgagatacat | Bacillus subtilis |
yxeD | yxeD | gacgGAATTtcttttcattcaagttgCATGATAataccgactcacgtcaatcgatacatggagggatcattcatg | Bacillus subtilis |
yxeE | yxeE | atgcGTGCCactgtgccaatgactaCATAAGTTataaggaattcaccc | Bacillus subtilis |
yxeK_1 | yxeK_1 | agaaaaaattaatcttaactcaTTGACAaacgtccaagacaaaggTACATTttgatttattcatatt | Bacillus subtilis |
yxeK_2 | yxeK_2 | attcataTTAAACGACTAGGAATATAGGAGTTTatttttcgcatt | Bacillus subtilis |
yxjC_1 | yxjC_1 | ttttTGTAAACGCTTTCTagttc | Bacillus subtilis |
yxjC_2 | yxjC_2 | atcgGAATAGTtggcccacgcttctCGTACATAtggaaaggg | Bacillus subtilis |
yxjI | yxjI | gagccTGAAACCTtttcgccacctatcCGTAATttcatacaag | Bacillus subtilis |
yxkC_1 | yxkC_1 | atattgacTAAGagaaataatataGGCATTATagtacatatgtttcgtac | Bacillus subtilis |
yxkC_2 | yxkC_2 | tcgtacattttattaca | Bacillus subtilis |
yxkJ | yxkJ | caatTGCAAACGGATACAattca | Bacillus subtilis |
yxkO | yxkO | ttttGTTTGAaaaagaaaagggacAGGAAAaataggaaaaga | Bacillus subtilis |
yxzE_1 | yxzE_1 | tcatccgtataacagatatggtgaaaaaagggagtgacgcga | Bacillus subtilis |
yxzE_2 | yxzE_2 | tgaaaTGAAACCGgtcagcgtttcatcCGTATAacagatatgg | Bacillus subtilis |
yyaC | yyaC | caaaGCATAaaaaatcatactgctGGATATACTGtaaacaacct | Bacillus subtilis |
yyaD | yyaD | tatgGCATGTTtgctttcctttattTATATAGTaacaataacggg | Bacillus subtilis |
yyaF_1 | yyaF_1 | ATCAaagggATTGgcaa | Bacillus subtilis |
yyaF_2 | yyaF_2 | agctgAAAAtgcttTTTT | Bacillus subtilis |
yybI | yybI | tatgTCTTTGAtgtgccattcctgCATATAATgattcattcagctg | Bacillus subtilis |
yycC | yycC | tgtgacatcttcttaca | Bacillus subtilis |
yycD | yycD | gatcGTTTCGgacagtaacaaggcGGGAAAaatgcaataaaa | Bacillus subtilis |
yydF | yydF | tttaggtacaatataTTGACAtgtattgaatgatatagAATAATtggtttatattagaaa | Bacillus subtilis |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.