Database '3D-footprint 20161221' (DNA Binding Sites 1-50)

If you want to search for an specific entry use the Search Entry Form.
If you want to search for a protein sequence or a DNA motif use the Sequence Search Form.


Pages: 1,  23456789101112131415161718192021

AccessionsSequenceOrganisms
1a02_AGGAAAATTTGTTTCATAGHomo sapiens
1a02_BCTATGAAACAAATTTTCCHomo sapiens
1a0a_CCTCACACGTGGGACTAGSaccharomyces cerevisiae
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
1a0a_DCTAGTCCCACGTGTGAGSaccharomyces cerevisiae
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
1a1f_B
1a1k_B
GCGTGGGACCMus musculus
1a1f_C
1a1k_C
GGTCCCACGCMus musculus
1a1g_B
1a1j_B
1aay_B
1zaa_A
GCGTGGGCGTMus musculus
1a1g_C
1a1j_C
1aay_C
1zaa_B
ACGCCCACGCMus musculus
1a1h_B
1a1i_B
1a1l_B
GCGTGGGCACMus musculus
1a1h_C
1a1i_C
1a1l_C
GTGCCCACGCMus musculus
1a3q_CGGGGAATCCCCHomo sapiens
1a3q_DGGGGATTCCCCHomo sapiens
1a66_BCGAGGAAAATTGHomo sapiens
1a66_CCAATTTTCCTCGHomo sapiens
1a6y_CCAACTAGGTCACUAGGTCAGHomo sapiens
1a6y_D
1hlz_D
CTGACCTAGTGACCTAGTTGHomo sapiens
1ahd_A
4xid_B
9ant_E
GAAAGCCATTAGAGDrosophila melanogaster
Drosophila subobscura
1ahd_B
4xic_C
4xid_C
5jlw_F
5jlx_C
9ant_F
CTCTAATGGCTTTCDrosophila melanogaster
Drosophila subobscura
1ais_CAACTTACTTTTTAAAGCPyrococcus woesei
1ais_EGCTTTAAAAAGTAAGTTPyrococcus woesei
1akh_C
1le8_C
CATGTAAAAATTTACATCASaccharomyces cerevisiae
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
1akh_D
1le8_D
TGATGTAAATTTTTACATGSaccharomyces cerevisiae
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
1am9_E
1am9_G
TTGCAGTGGGGTGATCTHomo sapiens
1am9_F
1am9_H
AGATCACCCCACTGCAAHomo sapiens
1an2_BGTGTAGGTCACGTGACCTACACHomo sapiens
1an4_CACCCGGTCACGTGGCCTACAHomo sapiens
1an4_DTGTAGGCCACGTGACCGGGTHomo sapiens
1apl_A
1k61_E
CATGTAATTCATTTACACGCSaccharomyces cerevisiae
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
1apl_B
1k61_F
GCGTGTAAATGAATTACATGSaccharomyces cerevisiae
Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
1au7_CTCCTCATGTATATACATGAGGAAGRattus norvegicus
1au7_DCTTCCTCATGTATATACATGAGGARattus norvegicus
1awc_DAGACCGGAAGTAACGGAMus musculus
1awc_ETCCGGUGUACTTCCGGTCATMus musculus
1b01_ECCGTGCACTStreptococcus agalactiae
1b01_FAGTGCACGGStreptococcus agalactiae
1b3t_C
1b3t_D
GGGAAGCATATGCTTCCCEpstein-Barr virus (strain B95-8) (HHV-4)
Human herpesvirus 4
1b72_DCTCTATGATTGATCGGCTGHomo sapiens
1b72_ECAGCCGATCAATCATAGAGHomo sapiens
1b8i_C
4cyc_C
4uus_C
4uus_G
CGCCATAAATCACDrosophila melanogaster
1b8i_D
4cyc_D
4uus_D
4uus_H
GTGATTTATGGCGDrosophila melanogaster
1bc7_AGACAGGATGTGHomo sapiens
1bc7_BCACATCCTGTCHomo sapiens
1bc8_A
4uno_B
ACCGGAAGTHomo sapiens
1bc8_B
4uno_C
ACTTCCGGTHomo sapiens
1bdh_B
1bdi_B
1jfs_B
1jft_B
1qpz_M
1vpw_B
2pua_B
2pub_B
2puc_B
2pud_B
2pue_B
2puf_B
2pug_B
TACGCAAACGTTTGCGTEscherichia coli
strain K12
1bdt_E
1bdv_E
1par_E
ATAGTAGAGTGCTTCTATCATEnterobacteria phage P22
Salmonella virus P22
1bdt_F
1bdv_F
1par_F
ATGATAGAAGCACTCTACTATEnterobacteria phage P22
Salmonella virus P22
1bf5_BGTTTCCCGTAAATGCHomo sapiens
1bf5_CGCATTTACGGGAAACHomo sapiens


Disclaimer

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research.