Database '3D-footprint 2022-04-03' (DNA Binding Motifs 201-250)

If you want to search for an specific entry use the Search Entry Form.
If you want to search for a protein sequence or a DNA motif use the Sequence Search Form.

Pages: 1234,  5,  678910111213141516171819202122232425262728293031

AccessionsNamesConsensusOrganismsDescription and notes
strain ATCC 700971 / NCTC 13129 / Biotype gravis
1ddn_BDIPHTHERIA TOX REPRESSORTTAGGTCorynebacterium diphtheriae
strain ATCC 700971 / NCTC 13129 / Biotype gravis
strain ATCC 700971 / NCTC 13129 / Biotype gravis

1c0w_BDIPHTHERIA TOXIN REPRESSORttAGGCorynebacterium diphtheriae
strain ATCC 700971 / NCTC 13129 / Biotype gravis

1f5t_ADIPHTHERIA TOXIN REPRESSORGGCTCorynebacterium diphtheriae
strain ATCC 700971 / NCTC 13129 / Biotype gravis

strain ATCC 700971 / NCTC 13129 / Biotype gravis

3iv5_ABDNA-binding protein fisTGTnTGnnnnnTGnGCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp optimal binding

3iv5_BDNA-binding protein fisCanACAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp optimal binding

3jr9_ABDNA-binding protein fisTGTnGAnnnnnTCnGCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp optimal binding

3jr9_BDNA-binding protein fisTanaCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp optimal binding

3jra_ABDNA-binding protein fisTAgntAnnnnnTGncCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp non consensus sequence

3jra_BDNA-binding protein fisTgncCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp non consensus sequence

3jrb_ABDNA-binding protein fisTGTnTGnnnnTTGnGCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp DNA F24

3jrb_BDNA-binding protein fisTGTnTGEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp DNA F24

3jrc_ABDNA-binding protein fisTGnnTgnnnnntCngCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp DNA F29

3jrc_BDNA-binding protein fisCAnaCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp DNA F29

3jrd_ABDNA-binding protein fisTGCnCAnnnnnCAnACAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp DNA F25

3jrd_BDNA-binding protein fiscanACAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp DNA F25

3jre_ABDNA-binding protein fisTGTntGnnnnnTgnGCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp DNA F26

3jre_BDNA-binding protein fisCanACAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp DNA F26

3jrf_ABDNA-binding protein fisTGTnAGnnnnnTCnGCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp DNA F27

3jrf_BDNA-binding protein fisCAnACAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp DNA F27

3jrg_ABDNA-binding protein fisTGTnGGnnnnnTCnGCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp non consensus

3jrg_BDNA-binding protein fiscnaCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp non consensus

3jrh_ABDNA-binding protein fisTGTnAcnnnnngGnGCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp non consensus

3jrh_BDNA-binding protein fisGAnACAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp non consensus

3jri_ABDNA-binding protein fisTGnnannnnnnncnGCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp non consensus

3jri_BDNA-binding protein fiscnaCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27 bp non consensus

4ihv_ABDNA-binding protein fisTGtnTGnnnnnTrnnCACrystal structure of Fis bound to 27 bp sequence DNA

4ihv_BDNA-binding protein fiscanaCACrystal structure of Fis bound to 27 bp sequence DNA

4ihw_ABDNA-binding protein fisTGtnngnnnnnTrnnCACrystal structure of Fis bound to 27 bp Inosine substituted

4ihw_BDNA-binding protein fisCanACACrystal structure of Fis bound to 27 bp Inosine substituted

4ihx_ABDNA-binding protein fisTGCnCAnnnnCAAACCrystal structure of Fis bound to 27 bp 2-Aminopurine substituted

4ihx_BDNA-binding protein fisTGTTTCrystal structure of Fis bound to 27 bp 2-Aminopurine substituted

4ihy_ABDNA-binding protein fisTGCnyAnnnnnCrnaCACrystal structure of Fis bound to 27bp Inosine substituted DNA

4ihy_BDNA-binding protein fisCAnACACrystal structure of Fis bound to 27bp Inosine substituted DNA

5ds9_ADNA-binding protein FisAGCnCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)
5ds9_ABDNA-binding protein FisAGCnCAnnnnnCAnACTEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)
5dtd_ADNA-binding protein FisTgngCGEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)
5dtd_ABDNA-binding protein FisCGTnnGnnnnnTCngCGEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)
5e3l_ABDNA-binding protein FisGGCnCAnnnnnCAnACCEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)
5e3l_BDNA-binding protein FisCAnACCEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)
5e3m_ADNA-binding protein FisAGCnCGEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)
5e3m_ABDNA-binding protein FisAGCnCGnnnnnCAnACTEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)
5e3n_ABDNA-binding protein FisTGCngAnnnnnCcnACAEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)
5e3n_BDNA-binding protein FisccnACAEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)
5e3o_ABDNA-binding protein FisTGGnGGnnnnnTcnCCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)
5e3o_BDNA-binding protein FisCCnCCAEscherichia coli
strain K12
Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)
6p0s_ABEDNA-binding protein FisGyCtGTTnnnTAnnCAEscherichia coli
strain K12
Crystal structure of ternary DNA complex "FX2" containing E. coli

6p0t_ABEDNA-binding protein FisTGTnTTnnnnACAGACTAnAEscherichia coli
strain K12
Crystal structure of ternary DNA complex "FX(1-2)-1Xis" containing E. coli


These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research.